Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu18-44
Clone ID Ayu18-44
Vector pU-17
Project egtc

Sequence tag Ayu18-44
Sequence
GGTCATGAAAGGGAACATCAACAACTATTTTAAGTGGCAAGAAGGAAGATCGAGTCTACCACAATCAATACTCGACCAAT
TCATTTGCTCTGAATAAACACCAGCACAGAGAAGACCCATGATAAGAGGAGGCATCTTGCACATAAATTCTGTCTCACTC
CAGCTGGGGAGTTCAAATGGAACGGGTCTGTTCACGGGTCCAAGGTCCTTACCATCTCAACCCTGAGACTCACCATCACA
CAGCTAGAGAGCAACATTCCTTCATCCTTCCTTCACCCCAATTGGGCTTCACACAGGGCTAATTGGATCAAGGCCGTTCA
GATGTGTAGTAAACCCAGAGAGTTTGCGTTGGCTCTCGCAATTCTGGAGTGTGCAGTTAAGCCAGTTGTGATGCTGCCAA
TATGGCGGGAG
Sequence Type mRNA
Unitrap ID UNI29378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106942054..106942829 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es