Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu18-51
Clone ID Ayu18-51
Vector pU-17
Project egtc

Sequence tag Ayu18-51
Sequence
CAGTGCCCGGGGTGGATCCCGTCGTGAGTCACAGCCCATTTGATCCTCATCACAGGAGTAGCGCTGCAGGAGAGGTTTAT
CGGAGCCACCTACCCACGCACTTGGATCCAGCTATGCCCTTTCACAGGGTTGG
Sequence Type mRNA
Unitrap ID UNI29379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62153922..62154050 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es