Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu18-71
Clone ID Ayu18-71
Vector pU-17
Project egtc

Sequence tag Ayu18-71
Sequence
GTGTTGTTCCAGCGGTTCTTTTACACTAAGTCCTTCGTGAAACATTCCATGGAGCATGTGTCCATGGCTTGTGTTCACCT
GGCTTCCAAAATAGAAGAGGCTCCGAGACGAATCAGGGATGTCATCAATGTATTCCATCGCCTTCGGCATCTGAGAGAGA
AAAAGAAGCCTGTGCCTCTGGTGCTTGATCAAGAGTATGTTAACCTAAAGAACCAGATTATAAAGGCAGAGAGACGGGTT
CTCAAGGAGTTGGGCTTTTGTGTCCATGTGAAGCACCCTCACAAGATAATCGTTATGTACCTTCAGGTGTTAGAATGTGA
GCGTAATCAACACCTGGTCCAGACTGCAGT
Sequence Type mRNA
Unitrap ID UNI29382

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155187298..155192094 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029068 (Ccnl2) NM_207678 cyclin L2 Gene [Source:MGI (curated);Acc:Ccnl2-001]

 
Come back to gene ENSMUSG00000029068


For any suggestions or comments, please send an email to unitrap@crg.es