Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-120
Clone ID Ayu21-120
Vector pU-17
Project egtc

Sequence tag Ayu21-120
Sequence
GAGGGTGTAACCGGGAAGGTGCTCGCGGCTGGAAGTCAGGGCAGCGGGTTGCGGGTTGCGGGAGGTGACTGCAGTCTCCC
GGCCAGGCTGGCGGCTGCGGGATCGGGACCCGCGTTCGAGTCTCCTACGCCGGGGCTGTGCTTGCTGGCTCCCTGCTCGA
TCTTCAGCCTGGGCGTCCCATCGGCAGACCTGTGCGCGCCCGTGGTTCTTGGACCCCGGGCCCAGTTCTTTG
Sequence Type mRNA
Unitrap ID UNI6237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125450612..125450842 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068394 (Cep152) NM_001081091 centrosomal protein 152 Gene [Source:MGI (curated);Acc:Cep152-001]

 
Come back to gene ENSMUSG00000068394


For any suggestions or comments, please send an email to unitrap@crg.es