Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRA012
Clone ID RRA012
Vector pGT1Lxf
Project baygenomics

Sequence tag RRA012
Sequence
CTCCTCTCTCGCTCTCTCCGCGGCTACAGCTGGACCCTTCTCCTTTGCCTTCGCCACCACTCCGTGCGTGCACATCCCTA
CAATGGCTAAAACAGCAATG
Sequence Type mRNA
Unitrap ID UNI81

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8509530..8509629 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es