Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NAISTrap_26v1079
Clone ID NAISTrap_26v1079
Vector pUPAT-egfp3ic
Project NAISTrap

Sequence tag NAISTrap_26v1079
Sequence
CGAAGAAAAGGTCANANAAGGAAATATCAATGCTGCAAAGACAATTGNNGACATCATCCGGACCTGCTTGGGACCTAAAT
CTATGATGAAGATGCTTGNTGGACCCAATGGGGAGGCATCGNGATGACCAATGATGGTAATGCCATTCTTCGAGAGATTC
AAGCCCAGCATCCCGCAGNAAAGTCCATGATTGAAATTAGCAGGACCCAGGATGAAGAG
Sequence Type mRNA
Unitrap ID UNI12357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88103288..88106752 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

 
Come back to gene ENSMUSG00000001416


For any suggestions or comments, please send an email to unitrap@crg.es