Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NAISTrap_18v1007
Clone ID NAISTrap_18v1007
Vector pUPAT-3ic
Project NAISTrap

Sequence tag NAISTrap_18v1007
Sequence
GACGCCCAAACGAANAACCCNGANGAAGAAGAGGAGGNTNNCGCTCCNCGGGTGGTTCATCCCAAAACTGATGAGCAGAG
ATGCCGGCTTCANGAAGCTTGTCAAGATATTCTTCTTTTCAAAAACCTNGATCNGGNACAGNTTTCTCNAGTTCTGGATG
NCATGTTTGAAAAGATTGNCAAANNTGNCGAGCATGGCANTGACCAGGGCGACNACGGNGACANCTTNTATGGCATANAA
CGGGGNNNCTNTGACATTNTAGAAACAAAAGATNNTCNTNCACGTTCTGTTGNCCAGTNTGACAACCGTGGAANTTTTGG
AGAACTAGCTCTGATGTACAATACCCCGAGAGNTGCTACCATCATCGNCACCTCANANGGCTCCCTTNGGGGATTGTCCC
GGGTGACTTTTAGAAGAATCATAGTG
Sequence Type mRNA
Unitrap ID UNI29399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108619203..108642795 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032601 (Prkar2a) NM_008924 protein kinase, cAMP dependent regulatory, type II alpha Gene [Source:MGI Symbol;Acc:MGI:108025]

 
Come back to gene ENSMUSG00000032601


For any suggestions or comments, please send an email to unitrap@crg.es