Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHA116
Clone ID YHA116
Cell line NULL
Vector pGT0pfs
Project baygenomics
Note NULL

Sequence tag YHA116
Sequence
CACACACGGGTATCATCTTTCACGCCCCATACACAGGGGTCTGTATGAAGCAGCACAAGAAGCTGACCCAGGCCATCCAG
AAAGCCAGGGAGTGTGGTCTTCTCAGTTACTACGTCCCCCAGGTTGAGCCCCGGGATGCTGACTTTGGTACTGTGCATGG
AGCTGTCATTGCGTCTCCCCCATCTCCTCACATGGCAGT
Sequence Type mRNA
Unitrap ID UNI29403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36047807..36049318 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024436 (Mrps18b) NM_025878 mitochondrial ribosomal protein S18B Gene [Source:MGI Symbol;Acc:MGI:1914223]

 
Come back to gene ENSMUSG00000024436


For any suggestions or comments, please send an email to unitrap@crg.es