Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BGB184
Clone ID BGB184
Cell line NULL
Vector pGT1Lxf
Project baygenomics
Note NULL

Sequence tag BGB184
Sequence
ATTACCTGGCGAGTGGATGGGCAGTATTTTGCTGTGAGTGTTGTTTGTCGACAAACAGAGGCTCGGAAGATCCGCGTATG
GAACCGAGAGTTTGCCTTGCAGTCAACCAGTGAGTCTGTGCCAGGACTGGGGCCCGCCCTGGCTTGGAAACCCTCAGGCA
GTTTGATTGCATCTACTCAAGATAAACCCAACCAGCAAGATGTTGTGTTTTTTGAGAAAAATGGACTTCTTCATGGACAT
TTTACACTTCCTTTCTTAAAAGATGAAGTTA
Sequence Type mRNA
Unitrap ID UNI8091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56803762..56805314 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028431 (Ikbkap) NM_026079 inhibitor of kappa light polypeptide enhancer in B-cells, kinase complex-associated protein Gene [Source:MGI (curated);Acc:Ikbkap-001]

 
Come back to gene ENSMUSG00000028431


For any suggestions or comments, please send an email to unitrap@crg.es