Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM375
Clone ID RRM375
Cell line NULL
Vector pGT0Lxf
Project baygenomics
Note NULL

Sequence tag RRM375
Sequence
TTGGAGGCCGTCTTGGAGCATGTGGAGGACTTCACTGATTCTGCCTACACCAGCCACGAGCACAGGGAACGGATCTTGGA
GCTGTCTTCTCAGGCGAGGACAGAGCTGCAGCAGCTCCTTTCCGTGTGGATGCAAACCCAAAGCAGGAAGACAAAGAGCG
CCGCCGAGGAGCTGGAACTCACAGTTCTGAAGATCAGCCACAGCCTGGACGAGCTGAGGAGAGAA
Sequence Type mRNA
Unitrap ID UNI2911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56845778..56848187 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es