Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ022
Clone ID RRJ022
Cell line NULL
Vector pGT0Lxf
Project baygenomics
Note NULL

Sequence tag RRJ022
Sequence
TGGGGCCAGGGTCTGCATCGGTGGGGGCTCTCCCGCAGCCTCCTCAGAAGTGGAATACTTGAACCTGCGGTTGAGTCTGC
TGGAGGCCCCAGCT
Sequence Type mRNA
Unitrap ID UNI29405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 75893656..75893749 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042659 (Arrdc4) NM_001042592 arrestin domain containing 4 Gene [Source:MGI (curated);Acc:Arrdc4-001]

 
Come back to gene ENSMUSG00000042659


For any suggestions or comments, please send an email to unitrap@crg.es