Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO496
Clone ID RRO496
Cell line NULL
Vector pGT2Lxf
Project baygenomics
Note NULL

Sequence tag RRO496
Sequence
CAGCCAAGGAAGTTCTCAACTCCAGAAAGCATAAAGCTCAGGGGATGCCAGAAGGTGGTGGGGCACTTGCAGAAGGATTT
CAAGCAAGCTGCAGCGTGTTTCAAATTTCGTA
Sequence Type mRNA
Unitrap ID UNI29406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32453174..32454446 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027668 (Mfn1) NM_024200 mitofusin 1 Gene [Source:MGI (curated);Acc:Mfn1-001]

 
Come back to gene ENSMUSG00000027668


For any suggestions or comments, please send an email to unitrap@crg.es