Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK136
Clone ID RRK136
Cell line NULL
Vector pGT2Lxf
Project baygenomics
Note NULL

Sequence tag RRK136
Sequence
AGCGGTGCAGCCATGGTGGGACACCTGAGCGAGGGGGCCATCG
Sequence Type mRNA
Unitrap ID UNI2899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75161730..75161772 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000751 (Rpa1) NM_026653 replication protein A1 Gene [Source:MGI (curated);Acc:Rpa1-001]

 
Come back to gene ENSMUSG00000000751


For any suggestions or comments, please send an email to unitrap@crg.es