Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XF129
Clone ID XF129
Cell line NULL
Vector pGT2Lxf
Project baygenomics
Note NULL

Sequence tag XF129
Sequence
GGGGGGGGGGGGGGGGTATACCTGAAACAACTCCTGGCCCCTTCCTCCAAGAAGGGTAAAGCCCGCCTGAGCCCCCGAAA
TGTGGGCGTCATCTCCCCGTACCGGAAGCAGGTAGAAAAAATCCGTTACTGCATCACAAAACTTGACCGAGAACTTCTCT
GGACTGGATGACATCAAAGATTTG
Sequence Type mRNA
Unitrap ID UNI9110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104599688..104599981 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es