Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XST032
Clone ID XST032
Vector pGT2TMpfs
Project baygenomics

Sequence tag XST032
Sequence
TCGCCCGCCTCGCCGCCTCGCGAATAACAAAGGATCCTGGAAAAGTTGGAGAAGATAAAGTACACCCAGTGTCCAGATCA
GGAGATTGACAGACCAG
Sequence Type mRNA
Unitrap ID UNI10116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68847690..68848557 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]

 
Come back to gene ENSMUSG00000034317


For any suggestions or comments, please send an email to unitrap@crg.es