Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC212
Clone ID XC212
Cell line NULL
Vector pGT1Lxf
Project baygenomics
Note NULL

Sequence tag XC212
Sequence
TGCTCCTTGTGGGCATCGCGGTCAGCACGGACTACTGGCTGTACATGGAGGAGGGGACAGTTTTGCCGCAGAACCAGACC
ACAGAGGTCAAGATGGCGTTGCACGCTGGCCTCTGGAGAGTCTGCTTCTTTGCAGGTCGGGAGAAGGGGCGCTGTGTGGC
TTCTGAGTACTTTCTTGAACCAGAGATCAACTTGGTGACGGAAAACTCGGAGAATATTCTAAAGACAGTGCGCACGGCTA
CACCCTTCCCTATGGTCAGTCTCTTCCTCGTGTTCACCGCCTTTGTCATCAGCAACATCGGCCACATCCGACCTCAGAGG
ACCATTCTTGCGTTCGTTTCTAGGCATCTTTTTCATTTTAT
Sequence Type mRNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3336746..3339123 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es