Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE069
Clone ID XE069
Cell line NULL
Vector pGT1Lxf
Project baygenomics
Note NULL

Sequence tag XE069
Sequence
AAGGGTTTTTTTTTTTTTTTTGACAAATATCCAGGCATCTATTTGTTTTTGGTTCATCCCAATGAAATGGTTCGGCGATG
GGCTATTCTGACTGCAAGAAACCTGGGGAAGGTGGACAGAGATGACTATTATGACAGACAGGAAGAAGGGACTTGCCTTT
CCATAGTCATTGAGCTGGGGCTTTTGGAAAGTCCAGACATTTACACATCTTCTGTGCTTGAAAAAGGCAAACTGATCCTT
TTGCCTGCACACATGTATGATACTACCAACTACAAAAACTATTGGCTAGGTATTTGCATGTTGTTGACTATTCTTGAGGA
GCAAGCCATGGATTCACTGTTGCTGGGCTCAGACAAGCAAAATGATTTTATGCAATCAATTCTTCACACCATGGAGAAGC
AATCGGAT
Sequence Type mRNA
Unitrap ID UNI23684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28989499..28995907 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es