Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_441D11-3
Clone ID CMHD-GT_441D11-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_441D11-3
Sequence
CGAATTCTCAGCCAAGGACATCAACAGGCACATGGTCTGCCTGGATAAGTACAGGGGTTTCGTGTGCATCGTCACCAACG
TGGCCTCGCAATGAGGCAAAACTGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATATGCTGAGTGTGGTTTA
CGAATCCTGGCCTTCCCCTGCAACCAGTTTGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGG
CTACAACGTCAAGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAG
TCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGC
GTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCAGGTGATAGAGAAGGACCTGCCGTGCTATCTCTAGCTAGCCCTACA
AGTGTGTGCCCCTACACCGAGCCCCCCTGCCCTGTGACCCCTGGAGCCTTCCACCCCGGCACTCATGAAGGTCTGCCTGA
AAACCAGCCTGCTGGTGGGGCAGTCCTGAGGACCTGGCGTGCATCCCTGCCGGAGGAAGGTCCAGAGGCCTGTGGCCCTG
GGCTCGAGCTTCACCCTGGCTGCCTTGTGGGAATAAAATGTA
Sequence Type mRNA
Unitrap ID UNI12783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 45595183..45595864 674
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078449 (AC153368.5)  

 
Come back to gene ENSMUSG00000078449


For any suggestions or comments, please send an email to unitrap@crg.es