Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_441F3-3
Clone ID CMHD-GT_441F3-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_441F3-3
Sequence
GTGCCAAGCGATCCGAGAGCCGGGTACCTCCGCCGGCCGACACACCCCTACCTTTCGACCGTGTGCTGCTAAATGAGCAG
GGCCATTTCGACCCCACTACTGGCAAGTTCACCTGCCAAGTGCCTGGCGTCTACTACTTTGCTGTGCACGCCACTGTCTA
CCGGGCCAGCTTGCAGTTTGATCTTGTCAAAAACGGGCAGTCCATCGCCTCTTTCTTCCAGTATTTTGGGGGGTGGCCCA
AGCCAGCCTCGCTCTCAGGGGGTGCGATGGTAAGGCTAGAACCTGAGGACCAGGTGTGGGTGCAGGTGGGCGTGGGTGAT
TACATTGGCATCTATGCCAGCATCAAGACAGACAGTACCTTCTCTGGATTTCTCGTCTATTCTGACTGGCACAGCTCCCC
AGTCTTCGCTTAAAACACAGTGAACCCGGAGCTGGCACTTGCTCCTCAGTGGAGGGTGTGACACTAACCCGCGCAGCGCA
TACCAGGAGGGCTGGCCCCCTGGAATATTGTGAATGACTTAGGAAGAGAGGGAGCCACTTCCGGTCCCACTGCTGGCAAT
GAATGGAGACAGGCTGTCTGAGGTCAAGACAGC
Sequence Type mRNA
Unitrap ID UNI29409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43916483..43917075 587
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079592 (C1qtnf5) NP_001035722 C1q and tumor necrosis factor related protein 5 Gene [Source:MGI (curated);Acc:C1qtnf5-008]

 
Come back to gene ENSMUSG00000079592


For any suggestions or comments, please send an email to unitrap@crg.es