Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_442B4-3
Clone ID CMHD-GT_442B4-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_442B4-3
Sequence
GTTTTGTTTTGTTTCATAAGATCCCACTGGATGGGTAGCTGAGATAAAGGAAAGACAAAGGCTGGGGCTGTGGTGCTTGT
TGCCTGACGCCCTGTGAGCTGAACTCTGGGACTGCTGTTGCCTATCCCAGGAAGTGCTGCTTATTTGAGGGTGTCTGGTG
GAAATGGGTAATCTCCGAGGATGTCTGCAGCCTGCTTGTTGTGAGCTGTGACTGGGGAACCCCAAGGCAGAGGCAGGGGT
CAGGCAGCTGAGAAGCAGCAGAAGAACACACTTAGATTCACCTTCTGTTCTTACAATAGTTCAAATATAGAATCGAAGTG
AAATCTCATTGGATTATGCCTCTCTAATGAAAAGCGAGCTGTTTGACTATACGGAAAATGTGCTGACATTAATTGCTTCT
GTTTATTAAAGGTGATTTGCAAATT
Sequence Type mRNA
Unitrap ID UNI13941

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59033384..59033808 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

 
Come back to gene ENSMUSG00000055254


For any suggestions or comments, please send an email to unitrap@crg.es