Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone LST093
Clone ID LST093
Vector pGT1TMtfa
Project baygenomics

Sequence tag LST093
Sequence
CTCGAGCTGCCGCGTCCGCCCGCGCCTGCTCTCCTGCTTTTGCTACCCCGAGGACGAAGGTGCACAGACTTTGCCGTCAG
GCTCCTAGCTCTCCTCCCGAAGTCCGCCCCAGCGAACATG
Sequence Type mRNA
Unitrap ID UNI672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143741263..143741383 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es