Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0211
Clone ID CC0211
Vector pGT0lxfT2
Project sanger

Sequence tag CC0211
Sequence
GAAGCAGGTTTTGAAGTTCACCCTGGACTGCACTCACCCTGTAGAAGATGGAATCATGGACGCTGCCAATTTTGAGCAGT
TCCTCCAGGAGAGAATCAAGGTGAATGGGAAAGCTGGCAACCTCGGCGGAGGAGTCGTGACCATCGAACGCAGCAAGAGC
AAGATCACTGTCACTTCAGAGGTGCCTTTCTCCAAAAG
Sequence Type mRNA
Unitrap ID UNI1121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151701622..151704237 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es