Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_434E7-3
Clone ID CMHD-GT_434E7-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_434E7-3
Sequence
GAAGGTGAATCTTCTGGAAAGAGGAAAGCGGAAGACGATGACAAAGCGAATAAAAAGCATAAGAAGTATGTGATCAGTGA
TGAAGAAGAAGAAGAAGATGACTGAGCTACAAACTGTGAATGCGTTTTATATATTTATTGTACAGCTTGTCTATAAATAC
AATGTAAACATGAGTTATTTTGATTGAGATTAATTGATCTGTTTGTGAAATTTTGATTGTAATAAAACATTTAAGGC
Sequence Type mRNA
Unitrap ID UNI2579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75314001..75314237 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042487 (Leo1) NM_001039522 Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2685031]

 
Come back to gene ENSMUSG00000042487


For any suggestions or comments, please send an email to unitrap@crg.es