Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_428G8-3
Clone ID CMHD-GT_428G8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_428G8-3
Sequence
AACTGCCTCATATACAAATAGCTCTGACGATGATACATCCCCCAGGGACAAGCAGCAAAAGAACTCTGCGTTGTTACCGC
TGCTTAGTGGTGGGTTGTACGCACATCACTGCTCAGAACGCCGTGCTTATGGAGACACTGGGTGCTCTGGGGGCACAGTG
CCGATGGGCTGCCTGCAACATCTACTCCACCCTCAATGAAGTGGCTGCTGCTCTCGCAGAAAATGGGTTTCCCGTCTTTG
CCTGGAAAGGAAAATCAGAAGATGACTTTTGGTGGTGCATTGACAGATGCGGGAAGGGGGAGGGCTGGCAGCCAAACATG
ATACTGGATGAAGGAGGAGAACTGACTCACTGGATCTATAAAAAGTATCCCA
Sequence Type mRNA
Unitrap ID UNI29416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29820568..29833674 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029772 (Ahcyl2) NM_021414 S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI (curated);Acc:Ahcyl2-002]

 
Come back to gene ENSMUSG00000029772


For any suggestions or comments, please send an email to unitrap@crg.es