Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GST071
Clone ID GST071
Vector pGT1.8TM
Project baygenomics

Sequence tag GST071
Sequence
AGTTTGGGCTCCCTGGTTGGTTGCTTTATTTTTTTTCCTCACAAAATTTTACCCCTCCCCCCCTGAGCCCGAGGTGCTGA
CGTCGCAAAAAAATTGGATA
Sequence Type mRNA
Unitrap ID UNI10120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054566..36054661 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es