Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_426C5-3
Clone ID CMHD-GT_426C5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_426C5-3
Sequence
TTTTCCTGTTCCAAGAAGTGCTGGTGATCACCCGAGCTGTCACTCACAACGAGCAGCTCTGCTATCAGTTGTACCGACAG
CCCATCCCTGTGAAGGACCTCACGCTGGAAGACCTGCAGGATGGAGAAGTGCGGCTGGGTGGCTCCCTGCGCGGGGCCTT
CAGCAACAACGAGAGAGTTAAAAACTTCTTCAGAGTCAGTTTCAAAAATGGATCCCAAAGTCAGACCCACTCACTACAAG
CCAACGACACCTTCAACAAACAGCAGTGGCTCAACTGTATCCGTCAGGC
Sequence Type mRNA
Unitrap ID UNI29421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28213461..28214927 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es