Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_429H7-3
Clone ID CMHD-GT_429H7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_429H7-3
Sequence
AATCCTGCTACCATATCCTCACTCCAGTTCAGGATTAAAGAGACAGAGTGTACTTCCACCCAGGAGAGACAGCCTAAAGA
CTGCGACTTCCTGGAGGATGGGGAGGAGAGAAATTGCACAGGGAAATTCTTCAGAAGGCGGCAGTCAACCTCCCTGACCT
TGACCTGCGACAGGGATTGCAGTCGAGAGGATACCCAAGAAACCAGTTTTAATGATAAGCAAGACGTCTCTGAAAAGGAA
AAGTTCAAAGATGTGCCCCCTCACATCAGGAACATTTATGAAGATGCCAAGTATGATATCATCGGCAACATCCTGAAAAA
TTTCTAGGGCTGGAAAGAGGAGGGAGGTGCTCCCTGCATACTATGACCTCCTCTTTACCTCCACTACCCATCTCCCCCTG
CTGCATTCAGGATCTGCCCCTCCTTCCTGCCCTTCCCAGGAACACCCCCTCTAGAGTAGCTCTAGCTCCTAAAACATCCA
TACCTTTGTCCATTTGCTTCCTTCTGCTGGGCCTTCCTGCCTTACCCTCTATCTGAAACCCTTATTGATTCTTCAAGGCC
CAAGTTCAAAAGTCCCCTCCAGCGGGAAGCCTCCTCATTCTCCCAGAGCCAAAGTCCTGCCCACATCAGTTCACTCATAA
TCTTCAAACCACATTGGTATTACCTGCTGTGTCCCCAGCCAGACAACCCTGTATCTATTCACAGCTGGGCCTCCCGGGCC
AGTTGCAGGTAGAATGAATATTTCAATGATGTGT
Sequence Type mRNA
Unitrap ID UNI13749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110323317..110325340 565
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032484 (Ngp) NM_008694 neutrophilic granule protein Gene [Source:MGI (curated);Acc:Ngp-001]

 
Come back to gene ENSMUSG00000032484


For any suggestions or comments, please send an email to unitrap@crg.es