Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_429C12-3
Clone ID CMHD-GT_429C12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_429C12-3
Sequence
ATCAAGGAGTTGCTGAAGAAGCTCGAGCAGCTTTCGGAAGAAGTTCTAGAAGTCCGGGGCGAGAATGCCCACCTCGCCCT
ACAGCTGCAGGACTCCCAGAAGAACCACGAAGAGATCATCTCCACATACAGGAGTCATCTACTGAATGCTGCTCGGGGCT
ACATGGAACAAGACGTCTACAACATCCTACTTCGAATCCTCAGCATGCAGGAGTGAGGCAGGCTCACTGTGTGCCCTCAG
GGATAAAGGCATTTCTCTTTTGGAATAATGAGGCTCGATCAAGCTGTGGGGGGCAGGTGGGTGGACGGTGATTACCCACT
AGTGGGTGCTGTGGGTGGGGCTTCACAGGACACACGAACTCCAGACCTGAAAACCTGGACCCTGGAATCAGCACAGATGA
GACCAGAATTGTGGATGTAAATTAGCTCCGTGGAAAATAAAGCAGAAAACAGATGG
Sequence Type mRNA
Unitrap ID UNI12962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96493069..96494955 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es