Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_418G4-3
Clone ID CMHD-GT_418G4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_418G4-3
Sequence
TTGCAAGTGTAGCTGTGGAAGACCAGCCAGACGTCAGTGCTGTCTTGTCGGCCTACAACCAACAAGGAGACCCTACAATG
TATGAAGAATACTACAGTGGACTGAAACACTTCATTGAATGTTCTCTGGACTGCCATCGAGCAGAGTTATCCCAACTCTT
TTACCCTCTGTTTGTACATATGTACTGGGAGCTAGTTTATAATCAACATGAAAATGAAGCC
Sequence Type mRNA
Unitrap ID UNI12911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47145471..47145690 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025049 (Taf5) NM_177342 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc:MGI:2442144]

 
Come back to gene ENSMUSG00000025049


For any suggestions or comments, please send an email to unitrap@crg.es