Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_418G2-3
Clone ID CMHD-GT_418G2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_418G2-3
Sequence
AGTTCCTCCTTCTGAGATTCAAGAGAAGCAGGCTCCAAGCTCCGTCAACTCAGTTCTCTACACAACTCCCCTTCACC
Sequence Type mRNA
Unitrap ID UNI15873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110525663..110525739 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032491 (Nradd) NM_026012 neurotrophin receptor associated death domain Gene [Source:MGI Symbol;Acc:MGI:1914419]

 
Come back to gene ENSMUSG00000032491


For any suggestions or comments, please send an email to unitrap@crg.es