Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_411E2-3
Clone ID CMHD-GT_411E2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_411E2-3
Sequence
GATCGGGAACAGAGTCTGACAGTGATGAGTCAGTACCAGAGCTCGAGGAACAAGACTCCACACAGACGGCCACGCAGCAA
GCCCAGCTGGCAGCCGCAGCAGAGATCGATGAAGAACCTGTTAGTAAAGCCAAGCAGAGTCGAAGTGAGAAGAAGGCAAG
GAAGGCTATGTCCAAACTGGGTCTTCGACAGGTTACAGGGGTTACGAGAGTCACTATCCGAAAATCTAAAAATATCCTCA
TTTGTCATCACAAAACCCGATGTCTACAAGAGCCCAGCTTCAGACACCTACATAGTGTTTGGGGAAGCCAAGATTGAAGA
TTTGTCTCAGCAAGCACAGTTAGCAGCTGCTGAGAAATTCAAAGTTCAAGGTGAAGCTGTTTCAAACATTCAGGAAAACA
CTCAGACTCCAACCGTCCAAGAGGAGAGTGAAGAAGAGGAGGTTGATGAGACGGGTGTGGAAGTTAAGGACATAGAACTG
GTCATGTCGCAAGCAAACGTATCAAGAGCAAAGGCTGTTCGAGCCCTGAAAAACAACAGTAATGATATTGTAAATGCTAT
TATGGAATTAACAATGTAACTATTTGACAGCGAAGACAACTCCCCCTTTCCCCCCTTTTTGGTGTTTGAAAAGTGGAACT
ACAGCTTGGTTTAAAATTTGTACTGTTTCTATCACTAATAAAGTTGTGGCTTCTTGTTG
Sequence Type mRNA
Unitrap ID UNI13436

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127483224..127485683 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es