Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_410D11-3
Clone ID CMHD-GT_410D11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_410D11-3
Sequence
GGCACCCAAAGACTCCCTATAGTGTCCAAGGTTTGGCTGTCAGGATTGTGAACAATGAAATCTGCAATCATCGGTACCAG
TTCCTCCTGCTGAAGAACCAGAAAAAGTTCATTGGGAACGACATGTTGTGTACAAGCTCAGAATGGGGCCTGGACACTTG
TCAGGACACCTCCGGAAGCTCTCTGGTTTGCCAGATGAACAAGACCTGGGTCCAGATGGGCGTGGTGAGCTGGAACTTTG
ACTGTGGCCGTCGCCAATTCCCAAGCGTCTACACCAGCACCTCCCACTTCACCCAGTGGGATCAAGAGACAGATTGGCGA
CCTGAAGTTTACCAGCATGGGCTGTCCCCTCCTTCCTGAGCCCATTCATCCTCACTGGCTACATTCTGCTGGTATCCTTG
GGCTCCCTGTGGCTCTTGTGAGCTGTGTTTCTATAACAGCCACTCCCAGAGGCTACTTTTCCCTCCTCTCTGCTCCGCCC
TCAGAAGACGTGGACACCGGAGGCTGAACAGGACTTCAGGACAGAGGGACTTGGGGAAGGGTCCTTGACCCACTGTGGGT
TTTGTTCCCCAGTTGTTCAATGAAGATGCTCTTGAACCTTTTTGAGCCATCTGAAGTTACCATGTTCTTGACTTTGACCA
AAACCCTTTAGAGCACCTCCCTCATAAAACTTGACTGTTTCCC
Sequence Type mRNA
Unitrap ID UNI29440

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110753819..110759018 512
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049719 (1700112C13Rik) NM_183103 RIKEN cDNA 1700112C13 gene Gene [Source:MGI Symbol;Acc:MGI:1921556]

 
Come back to gene ENSMUSG00000049719


For any suggestions or comments, please send an email to unitrap@crg.es