Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC481
Clone ID YTC481
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC481
Sequence
TACAAGGAGAGAATGACTGAGCTGTACGACTACCCCAAGTACAGCTGCCACTTCAAGAAAGGAAAGCGGTACTTTTATTT
TTACAATACAGGTTTGCAGAACCAACGCGTGTTATATGTGCAAGACTCCTTAGAGGGGGAGGCCAGAGTGTTCCTGGACC
CCAACACACTGTCGGATGATGGTACAGTGGCACTCCGAGGTTATGCCTTCAGTGAAGATGGCGAATACTTTGCCTATGGT
CTGAGCGCCAGCGGCTCCGACTGGGTGACGATCAAGTTCATGAAGGTCGATGGTGCCAAAGAGCTCCCGGATGTGCTGGA
GAGAGTCAAGTTCACCTGCATGGCCTGGACGCATGACGGGAAGGGAATGTTCTATAACTCATACCCGCAGCAGGACGGGA
AGAGCGATGGCACAGAGACATCCACCAATCTCCACCAAAAGCTCTGCTACCACGTCTTGGGGACGGATCAGTCAGAAGAT
ATTTTGTGTGCTGAGTTCCCCGATGAGCCTAAATGGATGGGAGGAGCTGAGCTATCCGACGATGGCCGGTACGTCTTGTT
ATCCATCTGGGAGGGATGTGATCCAGTAAACCGACTGTGGTACTGTGACCTCCAGCAAGAACCCAATGGTATCACC
Sequence Type mRNA
Unitrap ID UNI29441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44810865..44827682 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019849 (Prep) NM_011156 prolyl endopeptidase Gene [Source:MGI Symbol;Acc:MGI:1270863]

 
Come back to gene ENSMUSG00000019849


For any suggestions or comments, please send an email to unitrap@crg.es