Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC777
Clone ID YTC777
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC777
Sequence
ACACCACCACAGGCTGATGCTAAAAGCCAGCTGTTTGCACAGAGCAGGAGAGGCCAGGAAGTTCTCACTAGAGGGAAGCA
GTTCATGAAGCAGCATGTCTTTCCTGCTGAGAAGGAAGTAGCTGAATACTATGCTCAAAGTGGAAACTCAGCGGAAAAGT
GGGGACACCCCTTAGTGATCGAAAAACTAAAGGAAATGGCCAAAGCAGAGGGCCTGTGGAATTTGTTCTTGCCAGCTGTG
AGCGGTCTCAGCCAGGTGGACTATGCCTTGATTGCTGAAGAGACAGGAAAATGCTTTTTTGCTCCAGATGTTTTTAACTG
CCAAGCACCAGACACAGGCAACATGGAGGTACTGCACCTGTATGGCAGCGAGCAGCAGAAGAAGCAGTGGCTGGAGCCTC
TCCTGCGTGGCGATATCACCTCCGTCTTCCGTATGACAGAGCCCAAAGTCTCATCAAGCGATGTCAACAAGAATGAAGGC
AAAAGCCATTTTTTTTTTATGTGGCTATATAGTTAACGGCAAGAAGAGGTGGAGCAGC
Sequence Type mRNA
Unitrap ID UNI29446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103986504..103999781 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032558 (Acad11) NM_175324 nephronophthisis 3 (adolescent) Gene [Source:MGI (curated);Acc:Nphp3-001]

 
Come back to gene ENSMUSG00000032558


For any suggestions or comments, please send an email to unitrap@crg.es