Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC796
Clone ID YTC796
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC796
Sequence
GAGAAGCAGGATGCGGAGAACGAGAAGGAAGAACTCAGCAAGGAGAAGACAGACGACATCTCTGGCGAGGACAAGGATGA
GAAAGAGGCTGTGGCTTTCAAAGGCCGCAAAACTGCCAACAGGCAAGGCCGCCGCAAAGG
Sequence Type mRNA
Unitrap ID UNI12291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125548220..125549342 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es