Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P120G10
Clone ID P120G10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P120G10
Sequence
CCATCCATATCAACACCATCCCNNACNNCAAATACNACCNNCCAACACCTCCCTAGCCACACANGACACANNNCACAACC
TACAACCAACACGCCCACCCCCACCNNTTANNCATCCNTCGCACCNNACCCCCCACACCCCCAACNNNNTAAAAAACCGA
AAGGATTCATAATAANCAAANNACACCACAATAATTAACTATCTCCACACGNNAANGACANNTTGAANNAAGGAGGAAAA
ACGTTTTCCAAATCCCNNNTATTCCCCTCGTCNGGGAGGCAAAGGATCTCAACGGAGGCTCGGAAGGCCTCCTCCTACGC
GCAGCNNGCCTCCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP120G10
Sequence
CACCTAGAAAATAAGCTGGAAATAGTGGCAGATATCCTTGGCACTGGGGAGGCAG
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88377054..88377108 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]


SPLK-Sequence tag 5SP120G10
Sequence
TGCCCGTGTCTTCTAAGTGCCAGAATCGAGGGCTGTGCATCATCAGTCTNNNNNGAGCTTGGGAGATTGTATGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es