Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098H01
Clone ID P098H01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP098H01
Sequence
AGCAACTTCATTTTCCATTCATACCCTTAATTCCCTCCTTTCCAGTGTAAAGTAACATTTATAGGTTGGGGTAGTAGAAT
ATGGGCATATATGTACTGCCGAGGTGTGGTCAGTGTCATGGTCAAGAACATCTTCTAGGGGGAAGCATGACTTTCAGCTG
TAGACTGTCATTCACAGTAACTTAAAGCTATATTCTTGCTTTGCATTTGACTGTGTGGTACAGTGGTAAAGAATGTGTAC
AAT
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84780891..84781129 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


SPLK-Sequence tag 5SP098H01
Sequence
AGCTTTTAGAAGCCACCACAGGGCCCACCCATCTATTTTCAAAGCCAGCACTAATGCCAAGCAGATGCCTCTGTGGGTCC
TATCCTTTTGTCTTTTCACCTGAGTAATTCAGGCTTCTGTAGT
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84780747..84780870 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es