Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H005H03
Clone ID H005H03
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 3SH005H03
Sequence
CGGGGAGAGAGTGGAAAATGGGGGAGCTGCCAGGCAGGTCTTCTTTGGACATGCTCCCAGGCATTGAGTTGCCTGGGAAC
AAAGTT
Sequence Type genomic DNA
Unitrap ID UNI29456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83262042..83262126 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031715 (Smarca5) NM_053124 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Gene [Source:MGI (curated);Acc:Smarca5-001]


SPLK-Sequence tag 5SH005H03
Sequence
GATCCCCATCCAATTACGGGTGTATGCATGGAGAACTGAATGAATGGGAGCCTCGGGGAAGGATGATGGGCTTCTACNNN
TGCGCATTGCTTCCTTTTGAAGCCATTCGGAGGATTCGCTGTTGAACCACCTTCTTGGGGCTCCAGTGGGCCAGATGATG
GTGAC
Sequence Type genomic DNA
Unitrap ID UNI29456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83262141..83262305 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031715 (Smarca5) NM_053124 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Gene [Source:MGI (curated);Acc:Smarca5-001]

 
Come back to gene ENSMUSG00000031715


For any suggestions or comments, please send an email to unitrap@crg.es