Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XST087
Clone ID XST087
Vector pGT1TMpfs
Project baygenomics

Sequence tag XST087
Sequence
CAAGGAGCCATCCTCCCAGGANGCACTTCAAGGGCNCCGGGGCGCTGCTCCGTTGTGAAGTGGAGGCTCCGGACCCGGTG
CACGTGTACTGGCTGCTCAATGGGGTGCCTGTCCAGGACACCGAGCGACGGTTTGCCCAGGGCAGCAGCCTGAGTTTCGC
AGCTGTGGACCGGCTCCAGGATTCTGGTGCTTTCCAGTGTGTGGCTCGGGATAACGTCACTGGAGAGGAAGTCCGCAGTA
CTAATGCCTCCTTCAACATCAAAT
Sequence Type mRNA
Unitrap ID UNI10130

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46728464..46728726 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023972 (Ptk7) NM_175168 PTK7 protein tyrosine kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1918711]

 
Come back to gene ENSMUSG00000023972


For any suggestions or comments, please send an email to unitrap@crg.es