Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E063H02
Clone ID E063H02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE063H02
Sequence
AATTGGGGAGTGTCACCAAAAGTACTTGGGATGG
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53947314..53947347 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es