Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D124C05
Clone ID D124C05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD124C05
Sequence
CCCTTGTGCTAGCCTTAATCCTTTTCTTGCTCAACTAGACCTAGCCCTGCCCCAGATGTAGCACCCTCTCAGCTGGGATG
CAATTATCTGTACATTCTCCCCATATGCAATTATCTGTAGGCTGTACCTTGTGTTAGGGCTCCATCCAAGCTGTTTTCTC
TGCCAAATGTTAAGAAGACAATACCGCAAAAAAGTGTCATGGCAATCATGTATTTAAATATGTATTTACTTAAAACTTTA
CTCTGTACGTGTTACGCCATGAATAGAACAGTGTACCTAAATGTTACCTCCATTCTCTACAACCAGTGGAGTCCAGCTGG
ACGAAGGGCTTACACTTAAATATATGAATATATTAAACAGTTAGGCTGTAATTCTTTAAGCTAAACAGCTAGAATGAAAT
GTCAGGAATTCATCGGCTCATAAACAGCAGAACTTGCTGTTTCTGTAGCCA
Sequence Type genomic DNA
Unitrap ID UNI12993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35166237..35166687 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043681 (2200001I15Rik) NM_183278 RIKEN cDNA 2200001I15 gene Gene [Source:MGI Symbol;Acc:MGI:1916384]

 
Come back to gene ENSMUSG00000043681


For any suggestions or comments, please send an email to unitrap@crg.es