Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D015E08
Clone ID D015E08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D015E08
Sequence
AAACCCGGGACGTTCCGGGAAAATACGCCTCTTGCTTTTGCATTAATCGGAGTCTCGGGGTCTCACTCCGGGGCCTATCG
AGAGACTCTACAGGAGCAGGTAATTCACTGGTCCACAAGCGGTCTCCTTTACGTCGAAACCAAAAGACCTCAGCATCCTT
GAACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAAAACCAGCATGTAAATTTGAAGAGGGTCAAGATGTCTTAGCTA
GATGGTCAGATGGCTTGTTTTATCTTGGAACTATCAAAAAG
Sequence Type mRNA
Unitrap ID UNI10939

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108489801..108510042 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SD015E08
Sequence
TTTAAGGGGNNNCTGATTTCTTGTGTATTGCAGATAAACATATTGAAACAGAGCTGCTTCATCATATTTGAGGACAGTTC
CAAATCCTGGGTTCTCTGGAAGGACATCCAAACAGGCAGGTGCTATGTTACTCTTGAACATGATTGATATCGAAACTTAG
TTTTCTTCAACATGACTTTTTCTGATGCCAGTGATACTGAATATACTGTTCTTCAGTGGCTGGGTAGCATGTATAAGACG
Sequence Type genomic DNA
Unitrap ID UNI17974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108510123..108510362 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es