Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P151G10
Clone ID P151G10
Vector FlipROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP151G10
Sequence
CATAGGAATTGCCATGTGCGGATGTTAATAGTAACAATTTCTAGAGAAGCCAATATAACTGTAAGAAGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP151G10
Sequence
TATATGTGCAGTTTTACTTTGGTATCTTAAGAATGTAAAGACTTGCATATTGTAATTGTAATTAAGTAGATTTCAACTGA
ATTTTATTTAGTCTCTACTACATAGAAACCAGTTTGACTAATTTGGAGCATTACAAATTAGGGATTTGTCGGAAAGTAAT
AATTTTT
Sequence Type genomic DNA
Unitrap ID UNI14999

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68842275..68842442 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]

 
Come back to gene ENSMUSG00000034317


For any suggestions or comments, please send an email to unitrap@crg.es