Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P151G04
Clone ID P151G04
Vector FlipROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP151G04
Sequence
TTGGCAGTTAGTTGGAGTCTTGACAGAAAAACAAGTGCATAATATTTGCCTAGGCATCTTTAGATTTGTCTTCTGGGCTC
CTAGACAATGAGCTGCTTCTGATTTTACCCTTGTGTG
Sequence Type genomic DNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22255854..22255970 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]


SPLK-Sequence tag 3SP151G04
Sequence
TGCTTTCATTGCTTCTGGAGCAGAATAAATTTCAAAGTTCAAGTTCATTCTTAGTTTATGTAGTATTAGTCTCCAAATCC
TTGGGCAGTTCTTTAACAGTCAGACTTGGGACACCTTTTAAGGCTGTGGAGTTAGATACTTCTTATTTCTGCTCCAGAAA
GGTGGAAGAAAAAACCAATTGATTCATGTCAGTTGAAGCAATGAAACCATTATACCAGGTATCCTCAATTCTGCCCTCAC
TTATGTTTTCTTATTTTGGAAGAGGATTGCTCTCCTTGGCCATTTATCTCACAGAAGCTTATTTGTTTTTAAAGTTTCCA
AAACAGTATACAAATTAAAACTTTTGACATCTGCGTGTAGGAATCCCGTTCTGCTTCCCGAAGTGGAAGTGCTCACGGAT
CCGGCGAAATCTGCACGACATACACCTG
Sequence Type genomic DNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22255124..22255550 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

 
Come back to gene ENSMUSG00000022858


For any suggestions or comments, please send an email to unitrap@crg.es