Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P151C09
Clone ID P151C09
Vector FlipROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP151C09
Sequence
GATCTACTGTGTAGTGAAGAACTTCTGTTCTTCCAGTTTCTACTCCTAATGCGACCAT
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22750223..22750280 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]


SPLK-Sequence tag 3SP151C09
Sequence
TCACGCCTGTTTGTAGAAGAGTCAGGTAGCTGTCCTTTAAGAGACTGTAATACAGGAAGTCTAGTAGTTGTGTAGACTCA
GGCTGTGGTCTCTTATTTCCCGTTGTGACTGTCTTCAAAGAAATCAAGGACGAGATCTCTTTTGGGAAAATTTGTTACTG
GTAGCCTCTGTCCTAACAGCGGAGAAGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es