Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P151B10
Clone ID P151B10
Vector FlipROSAbetageo
Project ggtc

Sequence tag P151B10
Sequence
GCTTTCTGTAATTTCANNGCCTTCGGGGACAAGAGGGAAGGCGAGCGGTTCAAGCCGGGGGAGCTGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP151B10
Sequence
CCAGTTACGGTTGAAAAGGGGGTGTATATAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP151B10
Sequence
CCCCATTAAGCTAACCTTGGGGCTGGCCTGGGGCGAATTCTGATGCCTCCAGGTAGGTTTTTAATGGGGTGGGGGTGGTG
GGAAGCTTCCAAAACAGCCTGACCCTTTGGAAGCCTCTGGTTGCTCTTGGCTAAGCTGTCCCTCTGGCAGGCAGGCAGGC
GGCCTCTGGTTGTGAGTAACTTAACTTCCCTGTCTCTGGAGGAAGTTGGAAGCTGCAG
Sequence Type genomic DNA
Unitrap ID UNI17018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123063211..123063427 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es