Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P150F09
Clone ID P150F09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP150F09
Sequence
GGACCTATGNNNCCTCCCATGTGTGAGGGGGTGGGATAGAAAGCCCCCCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP150F09
Sequence
GAGGTGGCTTTGACCCGGGTGGCCCGGCAGCGCGACCGAGGAGGTGGCTGGACAGCTTGGAGAATGAACGGAGAAGCGGA
CTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGCCAAGGTATGGGTCCCCAGCTTCTCTTTTCAAACTTGTCTTTT
Sequence Type genomic DNA
Unitrap ID UNI29462

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102177625..102177784 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es