Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P150C09
Clone ID P150C09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P150C09
Sequence
GTGACGCCGCGAGACCGAGAATCTGTAGGAGCAGAACCAGAGGGAAGCGGGTGGGCCTGTCGGAGCGTTAGGATTTGAGC
TTGGGCCTTTTGAACCCAGGATCTCG
Sequence Type mRNA
Unitrap ID UNI3589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29169626..29169731 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071172 (Sfrs3) NM_013663 splicing factor, arginine/serine-rich 3 (SRp20) Gene [Source:MGI (curated);Acc:Sfrs3-001]


SPLK-Sequence tag 5SP150C09
Sequence
GATCTCTAAATGAATTCTCCACGTCGCGGCCTTTAGTTTGATGGCGCCTTTTTCTTCCTTGCTCCTGGTTTTCTTGGTAT
A
Sequence Type genomic DNA
Unitrap ID UNI3589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29170035..29170115 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071172 (Sfrs3) NM_013663 splicing factor, arginine/serine-rich 3 (SRp20) Gene [Source:MGI (curated);Acc:Sfrs3-001]


SPLK-Sequence tag 3SP150C09
Sequence
ATATATTTTTTAAGAAGGTCTTTTCGTATTTACTGAGCCCCTACAGTCTCATCTTTTTTTTATGCCGACTTGGTGTTTGC
TTTAAAAATCTTTTCTAATGAGGCTGCGTTTCTTAATGTAAATCATAGTTCACTTTGAGTTGGGTTTTTCTTTGACCTAT
TTGCTTTTAACAGGTGTGAAAACCGGGGATGGATGAGTTTCATTTGTCTTTTTGTTTGTTTTTTTAATTTTCGCGGAATG
GCTTGGTCGCTCAACTGAGTCTTGGGCACAGGGTGGGGTCACGGCAAAATAGGGTTAAATTTTTTAGTTTGATAATAGTC
GGTTTGAACATTATGGTGTATAGTAGGGAAGACACTTAAATGGCTTATTAAGTAGGGTTTTCATTTCGGAAGTGTGAAGT
TGAAGACTTACTGAGTGTATGTCCTCAAGGTTGTATGTTGTATGTCCTTTTAGTAAAGATTCTTTTACGCAGGAGTTTAG
GGTGCACGGGGCAGGCCACTACATGCCTAGCAGACCTCAACATTTACTTTTATGCACTTTTTACTAAAAGACGGGGGGGC
ACTAGCAAACTTCATAACTGTCATTCCTCTAGCCTGTTGAGCCACAAGCATGCTTGCCTTCCTAGCTATGATAGTTTTGT
TNNNNNACCTTTGTNNNNGTCCAAGATATTTATTTTTGTTTGTTCCTGAGACAGGTCTTGCTGTAAATCAGGCTGGCTGT
CTTNNNTTACTC
Sequence Type genomic DNA
Unitrap ID UNI3589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29170134..29170866 697
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071172 (Sfrs3) NM_013663 splicing factor, arginine/serine-rich 3 (SRp20) Gene [Source:MGI (curated);Acc:Sfrs3-001]

 
Come back to gene ENSMUSG00000071172


For any suggestions or comments, please send an email to unitrap@crg.es