Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P149H07
Clone ID P149H07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P149H07
Sequence
AAAACAAACCAAAAGGGCACAACANNCACAAACGAACCCANNCCCCACGCAAACATNNCNACAGACCACCCACACACCAA
CCCCCTAAACTATACNNGACCAAAANNTTAAACNNAACAGACCAANNNNCACNNNNTCACCCNNANNANNGCACAATATT
CCCAGGGCCATAACCNNCNNATACGANNCNNTAAANNCAGACACTAANNCAAAACTCACAAGCACAACCAACCAACCCNN
NCTCCACAAGTACACAACACCCNNCCCCCACTCCACACACCTAGCNNCACAANNNNACCAACCATGACAACANNNNCCAA
ACGAACAAACAAACACGNNACAACACAACCACTCCCCCAAACCTTCACTACAACCNNNNATCCAAGCAACGNNCNNCANN
AAAGTAAACNNCACCATACAGAATAATGCCCCACCACTCAACCAACATCCNNGCGTNNAATCACACAANNCACATACAGA
CTTGACCGCCCAAAGTCCAAAACAAAACACAAGAANNCCANNNCCACAANNCATAAAAACNNNNAAACAGACAGCGGGGA
AGAAGGAAAAACNNATCTACAACATCACCTCCCCTCCACNNNCCCGCAGCGACTGGGACGCGGGTCTACGTGGAATTTGA
TGACCTTGAGTGGGATAAACGGGAGTGGGTTAGAGTTTATGAAGATTTTTCAACTTTCTTGGTGGAATATCACTTAATCT
GGGCCAAAAGGAAGGACCCTAGCCAGACTCAGGGATCAAAGAGCAGACAAATTCAGTGGCCTGCACTG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66423790..66620819 166
NO GENE  


SPLK-Sequence tag 5SP149H07
Sequence
AATCTGAAAAAGGAATTGTTAAATGTTAACAGGAGATTGTTAGAAACTCTGGCTGTAGACATAAGCCCCGTGAATTTCCT
GTTAAGTACTAAACGGTGAGCTTTAACGTGTTTTGTCTGAGCAGCTGAGTTGTATTTGAGAACTGTAGATGATTTATTTA
AAAATATTTTTCGGGGAGGGCTCATCTGTTGGCCTCTTCCTCATGTGAATGGAATGTGGCGCAGCGTGGAGCCCCAAACA
GGATACAGTTGTTGGAGCATTCTTCCTATAGCGTGGTAGGCCCTTCTAGAAATATAGGCTCTCAGCCGGTCTATTTTGGC
TTTAGGCTATTTTTAAAGTTTGGTTAACACTAACAG
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649606..66649961 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


SPLK-Sequence tag 3SP149H07
Sequence
ATCCCCTAACAAATGGAAAAGGTGATTTGTTTCAACTAAATGTTCAGTTTTAAGTTAGTGTCTTTCACTTGGGGTTTCAA
AGATTCAAGTCTTTTGTGATTAGGGCCATATTCTACTGGGCTTGCTTCCCCTTAGGCTGAGGAAGTCCTCATAGAATGTC
TTTAGAGTCATGNNNTNNNTATGCATGAGTTCTACTGTCTGTACTTTCCAGAGCACCTACAGCAGAGAAACNTTATTAAA
GCTACAAAATCCATTTGTTTCCATTTTAACATGAATCTGTTTAATTTTTGATGTGTGTAAAGTACAAAAATTACTATGGT
TACATAGTTGATTGCCACTTTAAGANNTCATGGTTTCTTTTA
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649983..66650347 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es