Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P149F06
Clone ID P149F06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP149F06
Sequence
CTCTTTTGTACTCCAGAGAAAGCCCAAGCCACCTCCGGACCTTCCGTCATGGAAGACTCCTCGCTGCCTGTGGTTCCTGC
CCCCATCGCTGCTCCAGGACCAGCACCATCTGCCACTGCGCCTCGGGTCCCCTTTCACTGTAGCGAATGTGGCAAGAGTT
TCCGTTACCGATCAGACCTGAGGCGCCACTTTGCTCGACACACGGCTCTCAAGCCCCACGCATGTCCTCGATGCGGTAAG
GGCTTCAAGCATAGCTTCAACTTGGCTAACCACCTGCGCTCACACACTGGTGAACGACCCTACCGATGCTCTGCCTGCCC
TAAGGGATTCCGAGACTCCACTGGCCTGCTGCACCACCAGGTGAGTCCGGGGAGCCACATGTGGCTCAGACACTGGGACT
CCATTCCACTCAGGGAAAGGCAGCTAGAGATGGCCCTGGCTAGTAAATTTGCCCCGCAGCCGTGTGTTTACACCATCTTG
AAAATATGTTAGTGTACACCCAATAGGTCCATGTACACCCACCTCCTTTATTCTACAATGATCAATTTCCCCTACATGGA
ACACAGGCCTTCAAGGGAACTCAACGAGGCCTACAAATGATCAGGCACCAGGTANNNNNTTAAAGAAAGCAGTTTCT
Sequence Type genomic DNA
Unitrap ID UNI513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4964004..4964640 620
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]

 
Come back to gene ENSMUSG00000061374


For any suggestions or comments, please send an email to unitrap@crg.es